Web6.7 kb, E. coli-C. glutamicum shuttle vector, Kmr, pCES208 derivative; PH36, eGFP 8.9 kb, pCES208 derivative; PH36, eGFP 5’-GAGTAGCATGGGATCCATGAACTATCCA AATATACCTTTATATATCAACGGTGAG-3’ 5’-TCATGCTGTTTCATATGCTAATTGAGTTG CGTAATAAATTTGGTTCTGAGGT-3’ 5’- AATGGAATCAAAGTTAGAAAGGAGGAT … WebThe heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, …
Construction of heat-inducible expression vector of …
WebA fluorescence-based quantification assay for cellular PHB content using BODIPY was devised for the rapid fluorescence-activated cell sorting (FACS)-based screening of a … Webthe new Pvgb promoter-based vector system as a platform for metabolic engineering of C. glutamicum by investigating 5-aminovaleric acid (5-AVA) and gamma-aminobutyric acid (GABA) production ... several expression vector systems based on pCES208 plasmids were constructed. GFP was expressed in C. glutamicum under the control of increasing … my vintage baby dress
Metabolic engineering of Corynebacterium glutamicum for the ...
WebSep 1, 2024 · The pCES208 vector contains a fully synthetic promoter [ 32 ]. Bam HI and Nde I were the restriction sites used to clone the gene into the plasmids. BVMO was … With C. glutamicum producing eGFP, we performed an adaptive laboratory evolution based on the fluorescence intensity of each cell. C. glutamicum harboring pCES-H36-GFP in which the eGFP gene was expressed under the strong constitutive promoter (PH36) were cultivated and the cells exhibiting higher … See more After the seventh round screening, the sorted cells were spread on an agar plate and 10 individual clones were randomly picked for an analysis of eGFP … See more To verify that the nonsense mutation in the parB gene contributed to the increase in the plasmid copy number, we introduced a point mutation (C→A at the 21st … See more In general, the maintenance of high-copy-number plasmids in bacteria can give high metabolic load on the hosts, which consequently causes poor cell … See more To demonstrate the versatility of the high-copy-number plasmids, we examined the secretory production of endoxylanase from Streptomyces coelicolor which can … See more WebOct 7, 2016 · Engineered C. glutamicum strains harboring a pCES208-based plasmid for expression of target genes under strong synthetic promoters, such as H30 and H36, have been reported to efficiently produce GABA and cadaverine from renewable resources [30, 37]. Therefore, we transferred codon-optimized versions of the davAB genes into the … the simpsons eight misbehavin